TP53-mCherry endogenous reporter
An endogenous fluorescent reporter for TP53, designed, validated and delivery-ready in 41 minutes.
Deliverable preview
| Guide | Sequence (5′→3′) | Rank | Off-target |
|---|---|---|---|
| G1 | GACTCCACACGCAAATTTCC | #3 / 241 | 0 exonic |
| G2 | CAGGAAGCCAAAGGGTGAAG | #7 / 241 | 0 exonic |
| G3 | TCAGCATCTTATCCGAGTGG | #12 / 241 | 1 intronic |
The ask
A cell-biology collaborator needed an endogenous mCherry knock-in at the TP53 C-terminus in HEK293T — for live-cell imaging of p53 dynamics under genotoxic stress. The brief asked for: cross-validated SpCas9 guides at the stop codon, an HDR donor with optimized homology arms, junction-validation primers for genotyping, and a complete off-target report. Their concern: prior internal designs had been built off a single tool (CHOPCHOP) and one failed in the lab due to an unforeseen pseudogene match.
Approach
Locus retrieval and target selection
Pulled the canonical TP53 transcript (NM_000546.6) and surrounding genomic context from NCBI and Ensembl. Located the stop codon in exon 11 and defined a ±25-nt design window for fusion-compatible cuts.
Guide cross-validation
Generated guide candidates with CRISPOR, CHOPCHOP, and CRISPick in parallel — 241 total candidates across the design window. Filtered to guides ranked top-25 by at least two of the three tools, then re-scored against a custom Bowtie off-target index allowing 4 mismatches.
HDR donor design
Constructed an 1,800-bp donor cassette: 800-bp 5′ homology arm + GS linker + mCherry (codon-optimized, no internal BsaI/BsmBI) + stop + 800-bp 3′ homology arm. PAM-adjacent silent mutations introduced to prevent re-cutting after integration.
Validation primers
Designed two junction-validation primer pairs (5′ and 3′) anchored outside the homology arms, plus one internal Sanger primer pair spanning the mCherry insert. Tm-matched to ±0.6 °C and BLAST-checked for genome uniqueness.
Deliverables
16-page report: locus context, guide ranking matrices, off-target tables, donor map, validation primer specs, and step-by-step delivery protocol.
Annotated GenBank file with all features (homology arms, linker, mCherry, PAM-blocking mutations) — drop-in for SnapGene or Benchling.
All 5 guides + 4 validation primers in FASTA, plus an Excel workbook with thermodynamic parameters and order-ready synthesis sheets.
+ the full project folder. Every numbered script, sequence, intermediate alignment, BLAST output, JSON checkpoint, tool version, timestamped database query, methods write-up, and literature reference — re-runnable end-to-end, fully literature-validated, and independently auditable by specialised reviewer agents. The agent flags its own limitations honestly in every report.
Outcome
Delivered in 41 minutes vs. a typical 2-week internal design cycle. The collaborator confirmed all top-ranked guides were also flagged as preferred candidates by their internal pipeline, with no unforeseen pseudogene hits.
Want a case study like this for your team?
Request access and we'll run an analysis on a task that matters to you — typically delivered within 24 hours.
Request Access